Cloning and Functional Analysis of PagNAC47 Gene and Its Promoter from Poplar

doi:10.16420/j.issn.0513-353x.2024-0674

Acta Horticulturae Sinica ›› 2025, Vol. 52 ›› Issue (7): 1828-1842.doi: 10.16420/j.issn.0513-353x.2024-0674

• Genetic & Breeding·Germplasm Resources·Molecular Biology • Previous Articles Next Articles

Cloning and Functional Analysis of PagNAC47 Gene and Its Promoter from Poplar

SU Yuting, WANG Huilin, ZHAO Pan, ZHOU Xinyi, ZHENG Shuya, LIU Ran, GUO Huihong^*()

State Key Laboratory of Tree Genetics and Breeding，College of Biological Science and Technology，Beijing Forestry University，Beijing 100083，China

Received:2024-10-15 Revised:2025-04-21 Online:2025-07-23 Published:2025-07-23
Contact: GUO Huihong

Abstract

Abstract:

The PagNAC47 gene and its promoter were cloned from 84K poplar（Populus alba × Populus glandulosa）. Coding region of the PagNAC47 was 1 107 bp in length，encoding 368 amino acids，with a typical NAM domain of the NAC transcription factor family. It had the highest homology with the PtrNAC47 protein from P. trichocarpa，which was 92.2%. The promoter of PagNAC47 was 1 794 bp in length，containing the basic promoter elements of TATA-box and CAAT-box and auxin（IAA）response elements. RT-qPCR analysis showed that the expression level of PagNAC47 was significantly higher in old roots，secondary stems and mature leaves than that in young roots，primary stems and young leaves，and the expression level was the highest in mature leaves. Furthermore，detection of PagNAC47-specific promoter-driven GUS reporter gene revealed that the PagNAC47 was mainly expressed in vascular tissues of organs and mature leaves. The 35S promoter-linked PagNAC47 was transformed into 84K poplar，and it was found that transgenic poplar overexpressing PagNAC47 significantly increased plant height，stem thickness，secondary xylem width and layer，vessel and fiber cell area，and cambium layer compared with the wild type，and similar phenomena were also observed in the secondary xylem of roots. Compared with wild-type poplar，the net photosynthetic rate and chlorophyll content of overexpressing PagNAC47 84K poplar were significantly increased，and the photosynthetic performance was enhanced. The expression of PagNAC47 was inhibited by IAA，and the inhibitory effect gradually enhanced with the increase of IAA concentration.

Key words: poplar, PagNAC47, expression pattern, secondary xylem, photosynthesis, IAA

SU Yuting, WANG Huilin, ZHAO Pan, ZHOU Xinyi, ZHENG Shuya, LIU Ran, GUO Huihong. Cloning and Functional Analysis of PagNAC47 Gene and Its Promoter from Poplar[J]. Acta Horticulturae Sinica, 2025, 52(7): 1828-1842.

Figures/Tables 15

Table 1 The primers and sequences used in this study

用途 Application	引物名称 Primer name	上游引物（5′-3′） Forward primer	下游引物（5′-3′） Reverse primer
基因克隆 Gene cloning	PagNAC47 F1/R1	ACCTCTAGGCTTCTTTCCCAGC	AATCAGACCCCCACACGCATC
	PagNAC47 F2/R2	ACGGGGGACTCTAGA GGATCCACCTCTAGGCTTCTTTCCCAGC	TATTCCCTGACTGGT GGGCCCAATCAGACCCCCACACGCATC
启动子克隆 Promoter amplification	proPagNAC47 F1/R1	GAACTGTTGATGAAAGGGAGGG	TTTGTCTGTTCCAGTTGCCTT
	proPagNAC47 F2/R2	GACCATGATTACGCC AAGC TTTACAGGCTTCATCCCAGC	ACCACCCGGGGATCC TCTAGAGCTAATCTAAGATTAGAA
转基因植株鉴定 Identification of transgenic plant	pBI-121F/R	CGTCTTCAAAGCAAGTGGATT	CCAACGCTGATCAATTCCAC
实时荧光定量PCR Fluorescent quantitative real-time	RT-qPCR F/R	GTTTAGGTTCCACCCGACAGA	CTCCCCCAAGGAAGATTTAGC
内参基因UBQ Reference gene UBQ	F/R	AGACCTACACCAAGCCCAAGAAGAT	CCAGCACCGCACTCAGCATTAG

Fig.1 Cloning of PagNAC47

Fig. 2 Multiple alignments of PagNAC47 protein sequences The black bottom represents that several species share the same amino acid. A、B、C、D and E represent conserved motif. Pag：Populus alba × Populus glandulosa；Pal：Populus alba；Ptr：Populus trichocarpa；At：Arabidopsis thaliana

Fig. 3 Phylogenetic analysis of 84K poplar PagNAC47 and NAC47 proteins from other plant species

Fig. 4 Cloning of proPagNAC47

Fig. 5 PagNAC47 gene promoter sequence and cis-acting elements AuxRR-core：Auxin response element；LTR：Cryogenic responsive elements；ARE：Anaerobic-inducing elements；G-box：cis-Acting element of light reaction；TGACG-motif：Methyl jasmonate response element

Fig. 6 Expression pattern analysis of PagNAC47 in 84K poplar Different lowercase letters indicate significant differences（P < 0.05）

Fig. 7 PCR identification of proPagNAC47 transgenic Arabidopsis thaliana

Fig. 8 GUS detection of proPagNAC47::GUS transgenic Arabidopsis

Fig. 9 PCR（A），GUS detection（B）and RT-qPCR analysis（C）of PagNAC47 transgenic poplar 1：Negative control；2：False positive plants；3-5：Transgenic positive plants.Different lowercase letters indicate significant differences（P < 0.05）

Fig. 10 Statistics of overexpressed PagNAC47 84K poplar and wild-type 84K poplar Different lowercase letters indicate significant differences（P < 0.05）

Fig. 11 Cross-sectional cell diagramof overexpressed PagNAC47 84K poplar（OE）and wild-type 84K poplar Xy：Xylem；Ca：Cambium；Ph：Phloem；Ve：Vessel；Xf：Xylary fiber

Fig. 12 Statistics of overexpressed PagNAC47 84K poplar（OE）and wild-type 84K poplar（WT） Different lowercase letters indicate significant differences（P < 0.05）

Fig. 13 Analysis of photosynthetic indexes of overexpressed PagNAC47 84K poplar and wild-type 84K poplar Different lowercase letters indicate significant differences（P < 0.05）

Fig. 14 The effect of exogenous IAA treatment on the expression level of PagNAC47 in 84K poplar Different lowercase letters indicate significant differences（P < 0.05）

References 36

[1]	Ambavaram M M, Basu S, Krishnan A, Ramegowda V, Batlang U, Rahman L, Baisakh N, Pereira A. 2014. Coordinated regulation of photosynthesis in rice increases yield and tolerance to environmental stress. Nature Communications,5:5302.
[2]	An J P, Yao J F, Xu R R, You C X, Wang X F, Hao Y J. 2018. An apple NAC transcription factor enhances salt stress tolerance by modulating the ethylene response. Physiologia Plantarum, 164 (3):279-289.
[3]	Chen F M, Zheng G Y, Qu M N, Wang Y J, Lyu MJA, Zhu X G. 2021. Knocking out NEGATIVE REGULATOR OF PHOTOSYNTHESIS1increases rice leaf photosynthesis and biomass production in the field. Journal of Experimental Botany, 72 (5):1836-1849.
[4]	Chen Z H, Peng Z X, Liu S Q, Leng H Q, Luo J X, Wang F, Yi Y Y, de Dios V R, Lucas G R, Yao Y A, Gao Y F. 2022. Overexpression of PeNAC122 gene promotes wood formation and tolerance to osmotic stress in poplars. Physiologia Plantarum, 174 (4):e13751.
[5]	Cresta A, D’Alessandro S. 2023. Arabidopsis ANAC102,chloroplastic or nucleocytosolic localization? Genes, 14 (2):438.
[6]	Han K J, Zhao Y, Sun Y H, Li Y. 2023. NACs,generalist in plant life. Plant Biotechnology Journal, 21 (12):2433-2457.
[7]	Immanen J, Nieminen K, Smolander O P, Kojima M, Serra J A, Koskinen P, Zhang J, Elo A, Mahonen A P, Street N, Bhalerao R P, Paulin L, Auvinen P, Sakakibara H, Helariutta Y. 2016. Cytokinin and auxin display distinct but interconnected distribution and signaling profiles to stimulate cambial activity. Current Biology, 26 (15):1990-1997. doi: S0960-9822(16)30550-4 pmid: 27426519
[19]	Rauf M, Arif M, Fisahn J, Xue G P, Balazadeh S, Mueller-Roeber B. 2013. NAC transcription factor speedy hyponastic growth regulates flooding-induced leaf movement in Arabidopsis. The Plant Cell, 25 (12):4941-4955.
[20]	Sun P F, Wang H L, Zhao P, Yu Q L, He Y M, Deng W H, Guo H H. 2022. The regulation of xylem development by transcription factors and their upstream microRNAs. International Journal of Molecular Sciences, 22 (17):4857.
[21]	Takata N, Awano T, Nakata M T, Sano Y, Sakamoto S, Mitsuda N, Taniguchi T. 2019. Populus NST/SND orthologs are key regulators of secondary cell wall formation in wood fibers,phloem fibers and xylem ray parenchyma cells. Tree Physiology, 39 (4):514-525. doi: 10.1093/treephys/tpz004 pmid: 30806711
[22]	Tang X F, Wang D, Liu Y, Lu M Z, Zhuang Y M, Xie Z, Wang C P, Wang S M, Kong Y Z, Chai G H, Zhou G K. 2019. Dual regulation of xylem formation by an auxin-mediated PaC3H17-PaMYB199 module in Populus. New Phtologist, 225 (4):1545-1561.
[23]	Tang Yan, Yang Qiaomu, Tian Ji. 2024. Heterologous expression of MdNAC56-L gene in apple and its function. Journal of Beijing University of Agriculture, 39 (3):6-10. (in Chinese)
	唐艳, 杨乔木, 田佶. 2024. 异源表达苹果属MdNAC56-L基因的克隆及功能. 北京农学院学报, 39 (3):6-10.
[24]	Thirumalaikumar V P, Devkar V, Mehterov N, Ali S, Ozgur R, Turkan I, Mueller-Roeber B, Balazadeh S. 2018. NAC transcription factor JUNGBRUNNEN1 enhances drought tolerance in tomato. Plant Biotechnology Journal, 16 (2):354-366. doi: 10.1111/pbi.12776 pmid: 28640975
[8]	Jia D F, Jiang Q, van Nocker S, Gong X Q, Ma F W. 2019. An apple(Malus × domestica)NAC transcription factor enhances drought tolerance in transgenic apple plants. Plant Physiology and Biochemistry. 139:504-512.
[9]	Johnsson C, Jin X, Xue W Y, Dubreuil C, Lezhneva L, Fischer U. 2019. The plant hormone auxin directs timing of xylem development by inhibition of secondary cell wall deposition through repression of secondary wall NAC-domain transcription factors. Physiologia Plantarum, 165 (4):673-689.
[10]	Kondo Y, Nurani A M, Saito C, Ichihashi Y, Saito M, Yamazaki K, Mitsuda N, Ohme-Takagi M, Fukuda H. 2016. Vascular cell induction culture system using Arabidopsis leaves(VISUAL)reveals the sequential differentiation of sieve element-like cells. Plant Cell,28:1250-1262.
[11]	Kou X H, Wang S, Wu M S, Guo R Z, Xue Z H, Meng N, Tao X M, Chen M M, Zhang Y F. 2014. Molecular characterization and expression analysis of NAC family transcription factors in tomato. Plant Molecular Biology Reporter, 32 (2):501-516.
[12]	Kubo M, Udagawa M, Nishikubo N, Horiguchi G, Yamaguchi M, Ito J, Mimura T, Fukuda H, Demura T. 2005. Transcription switches for protoxylem and metaxylem vessel formation. Gene & Development, 19 (16):1855-1860.
[13]	Kunieda T, Kishida K, Kawamura J, Demura T. 2020. Influence of osmotic condition on secondary cell wall formation of xylem vessel cells induced by the master transcription factor VND7. Plant Biotechnology, 37 (4):465-469. doi: 10.5511/plantbiotechnology.20.1127a pmid: 33850435
[25]	von der Mark C, Cruz T M D, Blanco-Touriñan N, Rodriguez-Villalon A. 2022. Bipartite phosphoinositide-dependent modulation of auxin signaling during xylem differentiation in Arabidopsis thaliana roots. New Phtologist, 236 (5):1734-1747.
[26]	Wang Q, Wang Y Q, Lu X T, Chen Y, Chen Y, Wu X W, Zhou G K, Chai G H. 2025. Wood forming tissue-specific expression of PaTyDC4 promotes xylem differentiation and lignin deposition during secondary growth and confers drought tolerance in Populus. Horticultural Plant Journal, 11 (2):854-864.
[27]	Wei Z Y, Zhang H Y, Fang M, Lin S Y, Zhu M S, Li Y X, Jiang L M, Cui T L, Cui Y W, Kui H, Peng L, Gou X P, Li J. 2023. The Dof transcription factor COG 1 acts as a key regulator of plant biomass by promoting photosynthesis and starch accumulation. Molecular Plant,16:1759-1772.
[28]	Xie Z, Gui J S, Zhong Y, Li B, Sun J Y, Shen J H, Li L G. 2023. Screening genome-editing knockouts reveals the receptor-like kinase ASX role in regulations of secondary xylem development in Populus. New Phytologist, 238 (5):1972-1985.
[29]	Yamaguchi M, Mitsuda N, Ohtani M, Ohme-Takagi M, Kato K, Demura T. 2011. VASCULAR-RELATED NAC-DOMAIN7 directly regulates the expression of a broad range of genes for xylem vessel formation. The Plant Journal, 66 (4):579-590. doi: 10.1111/j.1365-313X.2011.04514.x pmid: 21284754
[30]	Yang Y, Yoo C G, Rottmann W, Winkeler K A, Collins C M, Gunter L E, Jawdy S S, Yang X H, Pu Y Q, Ragauskas A J, Tuskan G A, Chen J G. 2019. PdWND3A,a wood-associated NAC domain-containing protein,affects lignin biosynthesis and composition in Populus. BMC Plant Biology, 19 (1):486.
[14]	Lee K H, Du Q, Zhuo C L, Qi L Y, Wang H Z. 2019. LBD29-involved auxin signaling represses NAC master regulators and fiber wall biosynthesis. Plant Physiology, 181 (2):595-608.
[15]	Li L J, He Y, Zhang Z H, Shi Y F, Zhang X B, Xu X, Wu J L, Tang S Q. 2021. OsNAC 109 regulates senescence,growth and development by altering the expression of senescence and phytohormone associated genes in rice. Plant Molecular Biology,105:637-654.
[16]	Li Z Y, Wei X J, Tong X H, Zhao J, Liu X X, Wang H M, Tang L Q, Shu Y Z, Li G H, Wang Y F, Ying J Z, Jiao G A, Hu H H, Hu P S, Zhang J. 2022. The OsNAC23-Tre6P-SnRK1a feed-forward loop regulates sugar homeostasis and grain yield in rice. Molecular Plant,15:706-722.
[17]	Nouri M Z, Moumeni A, Komatsu S. 2015. Abiotic Stresses:Insight into gene regulation and protein expression in photosynthetic pathways of plants. International Journal of Molecular Sciences, 16 (9):20392-20416.
[18]	Ohtani M, Nishikubo N, Xu B, Yamaguchi M, Mitsuda N, Goue N, Shi F, Ohme-Takagi M, Demura T. 2011. A NAC domain protein family contributing to the regulation of wood formation in poplar. The Plant Journal, 67 (3):499-512. doi: 10.1111/j.1365-313X.2011.04614.x pmid: 21649762
[31]	Zhao P, Yu Q L, He Y M, Sun P F, Wang H L, Zhou X Y, Su Y T, Guo H H. 2024. PagHAM4a-PagSCL21 and PagHAM4b-PagTCP 20 modules positively regulate cambial activity and its differentiation into secondary xylem in poplar. Journal of Experimental Botany, 75 (22):7174-7189. doi: 10.1093/jxb/erae375 pmid: 39243137
[32]	Zhong R Q, Kandasamy M K, Ye Z H. 2021. XND 1 regulates secondary wall deposition in xylem vessels through the inhibition of VND functions. Plant & Cell Physiology, 62 (1):53-65.
[33]	Zhong R Q, Lee C H, Ye Z H. 2010. Functional characterization of poplar wood-associated NAC domain transcription factors. Plant Physiology, 152 (2):1044-1055. doi: 10.1104/pp.109.148270 pmid: 19965968
[34]	Zhong R Q, Ye Z H. 2015. The Arabidopsis NAC transcription factor NST 2 functions together with SND1 and NST1 to regulate secondary wall biosynthesis in fibers of inflorescence stems. Plant Signaling & Behavior, 10 (2):989746.
[35]	Zhou C G, Li C H. 2016. A Novel R2R3-MYB transcription factor BpMYB106 of Birch(Betula platyphylla)confers increased photosynthesis and growth rate through up-regulating photosynthetic gene expression. Frontiers in Plant Science,7:315.
[36]	Zhou J L, Zhong R Q, Ye Z H. 2014. Arabidopsis NAC domain proteins,VND 1 to VND5,are transcriptional regulators of secondary wall biosynthesis in vessels. PLOS ONE, 9 (8):e105726.

Cloning and Functional Analysis of PagNAC47 Gene and Its Promoter from Poplar

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 15

References 36

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	WANG Li, ZHANG Yuling, DAI Wei, BAO Ying, YUE Long, WANG Fenglin, YANG Aiguo. A New Poplar Cultivar‘Baicheng No. 2’ [J]. Acta Horticulturae Sinica, 2025, 52(S1): 241-242.
[2]	LI Meiqing, LUO Sifei, JIA Yaohao, WANG Weigui, and SUN Jin. Expression Analysis of the Cucumber Mg-Dechelatase Gene CsMDC and Functional Verification of Its Role in Regulating Chlorlorophyll Degradation [J]. Acta Horticulturae Sinica, 2025, 52(6): 1463-1476.
[3]	MAO Xin, YUAN Wenfei, GUO Yurun, XU Xinxin, LI Yi, ZHANG Yi, MIAO Yanxiu, BAI Longqiang, LI Yansu. Analysis of the Decomposition of Organic Materials and Nutrients Contents in Root Zone and Leaves of Cucumber Under Organic Substrate Planting Board Cultivation in Solar Greenhouse [J]. Acta Horticulturae Sinica, 2025, 52(2): 439-452.
[4]	YANG Yan, LIU Jun, ZHOU Xiaohui, LIU Songyu, ZHUANG Yong. Cloning and Functional Verification of SmWRKY4 Gene in Cold Tolerance of Solanum melongena [J]. Acta Horticulturae Sinica, 2025, 52(1): 101-110.
[5]	WANG Shanshan, GUO Rui, HE Ling, WU Chunhong, CHEN Chanyou, WAN Heping, ZHAO Huixia. Identification of Long Cowpea Lhc Gene Family and Its Expression Analysis Under Salt Stress [J]. Acta Horticulturae Sinica, 2025, 52(1): 111-122.
[6]	WANG Yanhong, XI Keyong, TIAN Ye, LIU Deqi, ZHOU Kegui, YIN Junliang, LIU Yiqing, ZHU Yongxing. Identification and Expression Pattern Analysis of GST in Zingiber officinale [J]. Acta Horticulturae Sinica, 2024, 51(8): 1803-1822.
[7]	CHEN Jiayue, DUAN Yingming, ZHOU Yan, XIAO Yang, BIAN Yinbing, GONG Yuhua. Identification，Expression and Function Analysis of ALDH Gene Family in Lentinula edodes [J]. Acta Horticulturae Sinica, 2024, 51(5): 1033-1046.
[8]	LUO Xinrui, ZHANG Xiaoxu, WANG Yuping, WANG Zhi, MA Yuanyuan, ZHOU Bingyue. Identification and Expression Analysis of Trihelix Gene Family in Common Bean [J]. Acta Horticulturae Sinica, 2024, 51(12): 2775-2790.
[9]	WANG Haizhen, YING Yaolin, WANG Yuqing, LÜ Ruiheng, HAN Lu. Analysis and Evaluation of Heat Tolerance of Actinidia arguta Cultivars in Extreme Arid Area [J]. Acta Horticulturae Sinica, 2024, 51(12): 2857-2870.
[10]	FENG Yiqing, QIU Shengnan, WU Yue, XIE Yang, ZHANG Xiaowei, BI Huangai, AI Xizhen. Effect of Exogenous Melatonin on the Cold Tolerance of Cucumber in Solar-Greenhouse [J]. Acta Horticulturae Sinica, 2024, 51(11): 2633-2644.
[11]	LU Jing, WEI Suyun, YIN Tongming, CHEN Yingnan. Research Progress on the Cytokinin Type-A Response Regulator Gene Family [J]. Acta Horticulturae Sinica, 2023, 50(9): 1867-1888.
[12]	MA Mengyu, HU Yaofang, GU Lin, LI Zhenjian, QIAN Yongqiang, JU Guansheng, LIU Junxiang, SUN Zhenyuan. Effect of Branch Light Treatment on Prolonging the Vase Life of Cut Rose [J]. Acta Horticulturae Sinica, 2023, 50(6): 1343-1354.
[13]	GAO Meina, SUN Mingfei, ZHU Jie, JING Junli, LI Jia, ZHOU Shasha, LIANG Bowen, XU Jizhong, LI Zhongyong. The Rooting Effect and Changes of IAA Content in Constriction，Girdling Treatment During Shoot Layering of Apple Rootstock‘Jizhen 2’ [J]. Acta Horticulturae Sinica, 2023, 50(5): 1063-1072.
[14]	YANG Jiangwei, DUAN Xiaoqin, ZHANG Feiyan, ZHANG Li, DENG Yurong, WANG Xiaofeng, ZHENG Zhiyong, ZHANG Ning, SI Huaijun. Root Architecture Alteration by Down-regulation of the StIAA22 Gene Using Artificial MicroRNA in Potato [J]. Acta Horticulturae Sinica, 2023, 50(10): 2091-2103.
[15]	YUAN Xin, XU Yunhe, ZHANG Yupei, SHAN Nan, CHEN Chuying, WAN Chunpeng, KAI Wenbin, ZHAI Xiawan, CHEN Jinyin, GAN Zengyu. Studies on AcAREB1 Regulating the Expression of AcGH3.1 During Postharvest Ripening of Kiwifruit [J]. Acta Horticulturae Sinica, 2023, 50(1): 53-64.