Functional Identification of a Nitrate Transport Gene PtNPF5.2 Related to Arbuscular Mycorrhizal Symbiosis in Poncirus trifoliata

doi:10.16420/j.issn.0513-353x.2026-0001

Acta Horticulturae Sinica ›› 2026, Vol. 53 ›› Issue (4): 1025-1037.doi: 10.16420/j.issn.0513-353x.2026-0001

• Research on Arbuscular Mycorrhizal Fungi in Horticultural Plants • Previous Articles Next Articles

Functional Identification of a Nitrate Transport Gene PtNPF5.2 Related to Arbuscular Mycorrhizal Symbiosis in Poncirus trifoliata

YU Miao, HUANG Shengyu, PAN Zhiyong^*()

College of Horticulture and Forestry Sciences，Huazhong Agricultural University，National Key Laboratory for Germplasm Innovation & Utilization of Horticultural Crops，Wuhan 430070，China

Received:2026-01-01 Revised:2026-03-17 Online:2026-04-25 Published:2026-04-20
Contact: PAN Zhiyong

Abstract

Abstract:

To investigate the molecular mechanism of nitrate（NO₃^-）transport via the arbuscular mycorrhiza（AM）pathway in citrus, this study used Poncirus trifoliata，a common citrus rootstock，to examine the expression pattern and subcellular localization of the NO₃^- transporter gene PtNPF5.2，as well as the role of its homologous genes in the AM symbiosis of the model plants Medicago truncatula and Solanum lycopersicum. The results showed that PtNPF5.2 was specifically induced by arbuscular mycorrhizal fungi（AMF），its promoter was activated in root cells containing arbuscules，and the encoded protein was localized to the plasma membrane. Interference or insertion mutation of the homologous gene MtNPF5.3 in Medicago truncatula did not affect AMF colonization. Similarly，CRISPR/Cas9 knockout of the homologous gene SlNPF5.2 in Solanum lycopersicum did not affect AMF colonization but led to a significant decrease in shoot NO₃^- content. In summary，PtNPF5.2 may be involved in regulating the NO₃^- allocation within the plant during AM symbiosis in Poncirus trifoliata，providing insights into the nitrogen transport mechanisms via the AM pathway in citrus.

Key words: Poncirus trifoliata, arbuscular mycorrhiza, nitrate transport protein, PtNPF5.2, nitrogen transport, gene functional identification

YU Miao, HUANG Shengyu, PAN Zhiyong. Functional Identification of a Nitrate Transport Gene PtNPF5.2 Related to Arbuscular Mycorrhizal Symbiosis in Poncirus trifoliata[J]. Acta Horticulturae Sinica, 2026, 53(4): 1025-1037.

Figures/Tables 9

Table 1 Primer sequence information used in this study

基因 Gene	引物名称 Primer name	引物序列（5′-3′） Primer sequence
Pt3g030260	pPtNPF5.2-GUS-F	TGTGGTCTCAGGAGTACGCCACAGGGAAAAAGCTTCA
	pPtNPF5.2-GUS-R	TGTGGTCTCACATTTAATCAATTATTACTTACTGCTCCCTGGAGAGAG
	PtNPF5.2-GFP-F	TGTGGTCTCAAATGGCCACATTAAAGCTAGGTGAAGAG
	PtNPF5.2-GFP-R	TGTGGTCTCACGAACCGCCGAATCCAGTGCCAGC
	qPtActin-F	CAAGCAGCATGAAGATCAA
	qPtActin-R	ATCTGCTGGAAGGTGCTGAG
	qPtNPF5.2-F	CCAAGCTCACCGTGGATTCT
	qPtNPF5.2-R	GCGCTTGGTATGAGTGTTGC
	qPtPT4-F	ATGCTCTTGACACTGCTAGGAC
	qPtPT4-R	AGCTTTGAGACGGTAGAGATGC
Medtr7g098040	MtNPF5.3-RNAi-F	GGGGACAAGTTTGTACAAAAAAGCAGGCTTACACGTCATTATAATGGTCACTGCATG
	MtNPF5.3-RNAi-R	GGGGACCACTTTGTACAAGAAAGCTGGGTTCGAAGTTATCAGCAACCCCTGT
	Tnt1-F	ACAGTGCTACCTCCTCTGGATG
	Tnt1-R	CAGTGAACGAGCAGAACCTGTG
	NF18636-F	TGACATGACCAGTGACTAGAAAGG
	NF18636-R	CATTACCATGAACTATTGCCTTACTCG
	qMtEF1-F	GAGACCCACAGACAAGCC
	qMtEF1-R	ACTGGCACAGTTCCAATACC
	qMtNPF5.3-F	CAATGTGGGTTGGGCTGTTG
	qMtNPF5.3-R	GTCAAAGGGCTTCCTGAGGG
	qMtPT4-F	GACACGAGGCGCTTTCATAGCAGC
	qMtPT4-R	GTCATCGCAGCTGGAACAGCACCG
	qMtBCP1-F	CCGGAAAGGACGTTATTCAA
	qMtBCP1-R	TGGCTACCATGATGACTCCA
	qRiEF1α-F	GCTATTTTGATCATTGCCGCC
	qRiEF1α-R	TCATTAAAACGTTCTTCCGACC
Solyc09g072780	CRI-SlNPF5.2-F	ATATATGGTCTCGTTTGTTCCTTTGCCACAACTTGGGTTTTAGAGCTAGAAATAGC
	CRI-SlNPF5.2-R	ATTATTGGTCTCGAAACGGTCCAACGTTGTCTTGTACCAAACTACACTGTTAGATTC
	qSlEF1-F	GGAACTTGAGAAGGAGCCTAAG
	qSlEF1-R	CAACACCAACAGCAACAGTCT
	qSlNPF5.2-F	AGGCAGCAGTGAAAACAGGA
	qSlNPF5.2-R	GTGCTAGCATTGTGCTTGGT
	qSlPT4-F	ATGGCGGGCAGAATGAGA
	qSlPT4-R	GCACAAGGCGTAGTGATG

Fig. 1 Expression analysis of PtNPF5.2 in Poncirus trifoliate A：Expression levels of PtNPF5.2 in different tissues；B：Expression levels of PtNPF5.2 at different time points after inoculation with AMF；C：Expression levels of PtPT4 at different time points after inoculation with AMF. NM：Non-mycorrhizal plants，AM：Mycorrhizal plants

Fig. 2 Activity of the PtNPF5.2 promoter in medicago roots

Fig. 3 Subcellular localization of PtNPF5.2 in Nicotiana benthamiana leaves

Fig. 4 Phylogenetic tree of PtNPF5.2 and its homologous genes in Medicago truncatula

Fig. 5 Analysis of gene expression and AMF colonization in MtNPF5.3 RNAi plants of Medicago truncatula A：Relative expression level of MtNPF5.3 in R108 and RNAi plants；B：Relative expression levels of AM symbiosis marker genes MtPT4，MtBCP1，and RiEF1α in R108 and RNAi plants；C-E：Statistics analysis of AMF colonization. F%：Percentage of root fragments colonized by hyphae，M%：Intensity of hyphal colonization in whole roots，A%：Arbuscule abundance in whole roots. t-test，* P < 0.05. The same below

Fig. 6 Analysis of gene expression and AMF colonization in the MtNPF5.3 insertion mutant NF18636 of Medicago truncatula A：Relative expression level of MtNPF5.3 in wild-type R108 and mutant NF18636；B：Relative expression levels of AM symbiosis marker genes MtPT4，MtBCP1，and RiEF1α in R108 and NF18636；C-E：Statistics of AMF colonization；F：Microscopic images of mycorrhizal structures in roots of R108 and NF18636. Ih：Intraradical hyphae，Arb：Arbuscules

Fig. 7 Analysis of gene expression and AMF colonization in SlNPF5.2 knockout tomato plants A-D：Relative expression levels of SlNPF5.2 and AM symbiosis marker gene SlPT4 in‘Micro-Tom'and two knockout lines（slnpf5.2-1 and slnpf5.2-2）；E-G：Statistics of AMF colonization；H-I：Microscopic images of mycorrhizal structures in the roots of‘Micro-Tom'and the two knockout lines. * P < 0.05；***P < 0.001

Fig. 8 NO3- content in roots and shoots of SlNPF5.2 knockout tomato plants Knockout lines slnpf5.2-1 and slnpf5.2-2 each have their own wild-type control‘Micro-Tom'

References 40

[1]	Breuillin-Sessoms F, Floss D S, Gomez S K, Pumplin N, Ding Y, Levesque-Tremblay V, Noar R D, Daniels D A, Bravo A, Eaglesham J B, Benedito V A, Udvardi M K, Harrison M J. 2015. Suppression of arbuscule degeneration in Medicago truncatula phosphate transporter 4 mutants is dependent on the ammonium transporter 2 family protein AMT2;3. The Plant Cell,27: 1352-1366.
[2]	Chen A Q, Gu M, Sun S B, Zhu L L, Hong S, Xu G H. 2011. Identification of two conserved cis-acting elements,MYCS and P1BS,involved in the regulation of mycorrhiza-activated phosphate transporters in eudicot species. New Phytologist,189:1157-1169.
[3]	Engler C, Youles M, Gruetzner R, Ehnert T M, Werner S, Jones J D, Patron N J, Marillonnet S. 2014. A golden gate modular cloning toolbox for plants. ACS Synthetic Biology,3:839-843.
[4]	Fan Z Y, Wu Y F, Zhao L Y, Fu L N, Deng L L, Deng J R, Ding D K, Xiao S Y, Deng X X, Peng S, Pan Z Y. 2022. MYB308-mediated transcriptional activation of plasma membrane H⁺-ATPase 6 promotes iron uptake in citrus. Horticulture Research,9:uhac088.
[5]	Govindarajulu M, Pfeffer P E, Jin H, Abubaker J, Douds D D, Allen J W, Bücking H, Lammers P J, Shachar-Hill Y. 2005. Nitrogen transfer in the arbuscular mycorrhizal symbiosis. Nature,435:819-823.
[6]	Guether M, Balestrini R, Hannah M, He J, Udvardi M K, Bonfante P. 2009a. Genome-wide reprogramming of regulatory networks,transport,cell wall and membrane biogenesis during arbuscular mycorrhizal symbiosis in Lotus japonicus. New Phytologist,182:200-212.
[7]	Guether M, Neuhäuser B, Balestrini R, Dynowski M, Ludewig U, Bonfante P. 2009b. A mycorrhizal-specific ammonium transporter from Lotus japonicus acquires nitrogen released by arbuscular mycorrhizal fungi. Plant Physiology,150:73-83.
[8]	Gu R L, Duan F Y, An X, Zhang F S, von Wirén N, Yuan L X. 2013. Characterization of AMT-mediated high-affinity ammonium uptake in roots of maize(Zea mays L.). Plant and Cell Physiology,54:1515-1524.
[9]	Hodge A, Campbell C D, Fitter A H. 2001. An arbuscular mycorrhizal fungus accelerates decomposition and acquires nitrogen directly from organic material. Nature,413:297-299.
[10]	Hu B, Wang W, Ou S J, Tang J Y, Li H, Che R H, Zhang Z H, Chai X Y, Wang H R, Wang Y Q, Liang C Z, Liu L C, Piao Z Z, Deng Q Y, Deng K, Xu C, Liang Y, Zhang L H, Li L G, Chu C C. 2015. Variation in NRT1.1B contributes to nitrate-use divergence between rice subspecies. Nature Genetics,47:834-838.
[11]	Hui J, An X, Li Z B, Neuhäuser B, Ludewig U, Wu X N, Schulze W X, Chen F J, Feng G, Lambers H, Zhang F S, Yuan L X. 2022. The mycorrhiza-specific ammonium transporter ZmAMT3;1 mediates mycorrhiza-dependent nitrogen uptake in maize roots. The Plant Cell, 34:4066-4087.
[12]	Hwang C F, Lin Y, D'Souza T, Cheng C L. 1997. Sequences necessary for nitrate-dependent transcription of Arabidopsis nitrate reductase genes. Plant Physiology,113:853-862.
[13]	Javot H, Penmetsa R V, Breuillin F, Bhattarai K K, Noar R D, Gomez S K, Zhang Q, Cook D R, Harrison M J. 2011. Medicago truncatula mtpt4 mutants reveal a role for nitrogen in the regulation of arbuscule degeneration in arbuscular mycorrhizal symbiosis. The Plant Journal,68:954-965.
[14]	Ji C Y, Song F, He C, An J Y, Huang S Y, Yu H M, Lu H, Xiao S Y, Bucher M, Pan Z Y. 2023. Integrated miRNA-mRNA analysis reveals candidate miRNA family regulating arbuscular mycorrhizal symbiosis of Poncirus trifoliata. Plant,Cell & Environment,46:1805-1821.
[15]	Kobae Y, Tamura Y, Takai S, Banba M, Hata S. 2010. Localized expression of arbuscular mycorrhiza-inducible ammonium transporters in soybean. Plant and Cell Physiology,51:1411-1415.
[16]	Koegel S, Ait Lahmidi N, Arnould C, Chatagnier O, Walder F, Ineichen K, Boller T, Wipf D, Wiemken A, Courty P E. 2013. The family of ammonium transporters(AMT)in Sorghum bicolor:two AMT members are induced locally,but not systemically in roots colonized by arbuscular mycorrhizal fungi. New Phytologist,198:853-865.
[17]	Konishi M, Yanagisawa S. 2010. Identification of a nitrate-responsive cis-element in the Arabidopsis NIR1 promoter defines the presence of multiple cis-regulatory elements for nitrogen response. The Plant Journal,63:269-282.
[18]	Krouk G, Lacombe B, Bielach A, Perrine-Walker F, Malinska K, Mounier E, Hoyerova K, Tillard P, Leon S, Ljung K. 2010. Nitrate-regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants. Developmental Cell,18:927-937.
[19]	Limpens E, Ramos J, Franken C, Raz V, Compaan B, Franssen H, Bisseling T, Geurts R. 2004. RNA interference in Agrobacterium rhizogenes-transformed roots of Arabidopsis and Medicago truncatula. Journal of Experimental Botany,55:983-992.
[20]	Lu S W, Zhang Y, Zhu K J, Yang W, Ye J L, Chai L J, Xu Q X, Deng X. 2018. The citrus transcription factor CsMADS 6 modulates carotenoid metabolism by directly regulating carotenogenic genes. Plant Physiology,176:2657-2676.
[21]	Martín Y, Navarro F J, Siverio J M. 2008. Functional characterization of the Arabidopsis thaliana nitrate transporter CHL 1 in the yeast Hansenula polymorpha. Plant Molecular Biology,68:215-224.
[22]	Morales de Los Ríos L, Pham T D, Perez T, Ben Amar M, Corratgé-Faillie C, Barbier F, Lacombe B. 2026. Functional characterization of NRT1/PTR FAMILY transporters:looking for a needle in a haystack. New Phytologist,249:1124-1144.
[23]	Pumplin N, Harrison M J. 2009. Live-cell imaging reveals periarbuscular membrane domains and organelle location in Medicago truncatula roots during arbuscular mycorrhizal symbiosis. Plant Physiology,151:809-819.
[24]	Rastogi R, Bate N J, Sivasankar S, Rothstein S J. 1997. Footprinting of the spinach nitrite reductase gene promoter reveals the preservation of nitrate regulatory elements between fungi and higher plants. Plant Molecular Biology,34:465-476.
[25]	Smith S E, Smith F A. 2011. Roles of arbuscular mycorrhizas in plant nutrition and growth:new paradigms from cellular to ecosystem scales. Annual Review of Plant Biology,62:227-250.
[26]	Smith S E, Smith F A. 2012. Fresh perspectives on the roles of arbuscular mycorrhizal fungi in plant nutrition and growth. Mycologia,104:1-13.
[27]	Sun J, Bankston J R, Payandeh J, Hinds T R, Zagotta W N, Zheng N. 2014. Crystal structure of the plant dual-affinity nitrate transporter NRT1.1. Nature,507:73-77.
[28]	Trouvelot A, Kough J, Gianinazzi-Pearson V. 1986. Evaluation of VA infection levels in root systems. Research for estimation methods having a functional significance//: Gianinazzi-Pearson V, Gianinazzi S. Physiological and Genetical Aspects of Mycorrhizae. Paris:INRA Press:217-221.
[29]	Tsay Y F, Schroeder J I, Feldmann K A, Crawford N M. 1993. The herbicide sensitivity gene CHL 1 of Arabidopsis encodes a nitrate-inducible nitrate transporter. Cell,72:705-713.
[30]	Wang S S, Chen A Q, Xie K, Yang X F, Luo Z Z, Chen J D, Zeng D C, Ren Y H, Yang C F, Wang L X, Feng H M, López-Arredondo D L, Herrera-Estrella L R, Xu G H. 2020. Functional analysis of the OsNPF4.5 nitrate transporter reveals a conserved mycorrhizal pathway of nitrogen acquisition in plants. Proceedings of the National Academy of Sciences of the United States of America,117:16649-16659.
[31]	Wang W, Hu B, Yuan D Y, Liu Y Q, Che R H, Hu Y C, Ou S J, Liu Y X, Zhang Z H, Wang H R, Li H, Jiang Z M, Zhang Z L, Gao X K, Qiu Y H, Meng X B, Liu Y X, Bai Y, Liang Y, Wang Y Q, Zhang L H, Li L G, Sodmergen, Jing H C, Li J Y, Chu C C. 2018. Expression of the nitrate transporter gene OsNRT1.1A/OsNPF6.3 confers high yield and early maturation in rice. Plant Cell,30:638-651.
[32]	Wang Z H, Zhang S Q, Liang J W, Chen H, Jiang Z J, Hu W T, Tang M. 2024. Rhizophagus irregularis regulates RiCPSI and RiCARI expression to influence plant drought tolerance. Plant Physiology,197:kiae645.
[33]	Wu Q S, Liu C Y, Zhang D J, Zou Y N, He X H, Wu Q H. 2016. Mycorrhiza alters the profile of root hairs in trifoliate orange. Mycorrhiza,26:237-247.
[34]	Wu Q S, Xia R X. 2006. Arbuscular mycorrhizal fungi influence growth,osmotic adjustment and photosynthesis of citrus under well-watered and water stress conditions. Journal of Plant Physiology,163:417-425.
[35]	Xing H L, Dong L, Wang Z P, Zhang H Y, Han C Y, Liu B, Wang X C, Chen Q J. 2014. A CRISPR/Cas 9 toolkit for multiplex genome editing in plants. BMC Plant Biology,14:327.
[36]	Xu G H, Fan X R, Miller A J. 2012. Plant nitrogen assimilation and use efficiency. Annual Review of Plant Biology,63:153-182.
[37]	Xu S, Wei Y F, Zhao P Z, Sun Y W, Gao K X, Yin C C, Wang C M, Fang R X, Ye J. 2025. A nitrate transporter OsNPF6.1 promotes nitric oxide signaling and virus resistance. Plant,Cell & Environment,48:6493-6508.
[38]	Yu H M, Bai F X, Ji C Y, Fan Z Y, Luo J Y, Ouyang B, Deng X X, Xiao S Y, Bisseling T, Limpens E, Pan Z Y. 2023. Plant lysin motif extracellular proteins are required for arbuscular mycorrhizal symbiosis. Proceedings of the National Academy of Sciences of the United States of America,120:e2301884120.
[39]	Zeng T, Holmer R, Hontelez J, Te Lintel-Hekkert B, Marufu L, de Zeeuw T, Wu F, Schijlen E, Bisseling T, Limpens E. 2018. Host- and stage-dependent secretome of the arbuscular mycorrhizal fungus Rhizophagus irregularis. The Plant Journal,94:411-425.
[40]	Zeng Z, Liu Y, Feng X Y, Li S X, Jiang X M, Chen J Q, Shao Z Q. 2023. The RNAome landscape of tomato during arbuscular mycorrhizal symbiosis reveals an evolving RNA layer symbiotic regulatory network. Plant Communications,4:100429.

Functional Identification of a Nitrate Transport Gene PtNPF5.2 Related to Arbuscular Mycorrhizal Symbiosis in Poncirus trifoliata

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 9

References 40

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	ZHANG Wei, YIN Xilong, FENG Zengwei, LIU Xiaodi, ZHOU Yang, ZHU Honghui, YAO Qing. Arbuscular Mycorrhizal Fungi-Specific Lipid Allocation Patterns in Citrus Mycorrhizae in Response to Drought Stress [J]. Acta Horticulturae Sinica, 2026, 53(4): 1013-1024.
[2]	GAO Yawen, SUN Linjiao, LIU Yusong, SUN Wentai, XU Mingna, SONG Lefen, WANG Xuemei, WANG Gongshuai, WANG Mei, YIN Chengmiao, MAO Zhiquan. Mechanism of Synergistic Alleviation of Apple Replant Disease by Arbuscular Mycorrhizal Fungi and Talaromyces pinophilus LZ1 [J]. Acta Horticulturae Sinica, 2026, 53(4): 1038-1056.
[3]	RUI Wenjing, LI Jing, ZHANG Jing, ZHANG Xiaodan, WANG Cheng, XIE Jianming. Mechanisms and Regulation of the Synergistic Interactions Among Plants，Arbuscular Mycorrhizal Fungi，and Rhizosphere Microorganisms [J]. Acta Horticulturae Sinica, 2026, 53(4): 923-937.
[4]	LI Feng, YAN Wenhui, LENG Hao, XIANG Dan, LIANG Bin, LI Min, LI Baoshen, ZHANG Lin. Progress of the Application of Arbuscular Mycorrhizal Fungi in Horticultural Crops [J]. Acta Horticulturae Sinica, 2026, 53(4): 938-954.
[5]	YE Guojian, FENG Zengwei, LIU Xiaodi, CHEN Meng, XIE Xiaolin, YAO Qing, DENG Mingrong, ZHU Honghui. Arbuscular Mycorrhizal Fungi in Orchard Ecosystems：Diversity，Environmental Responses，and Mechanisms in Enhancing Fruit Tree Stress Resistance [J]. Acta Horticulturae Sinica, 2026, 53(4): 955-971.
[6]	XIAO Wang, ZHANG Fei, ZHENG Fengling, ZOU Yingning, WU Qiangsheng. Mechanisms and Challenges in the Application of Arbuscular Mycorrhizal Fungi in Enhancing Drought Tolerance in Fruit Trees [J]. Acta Horticulturae Sinica, 2026, 53(4): 972-984.
[7]	ZANG Jiaojiao, SHI Zhaoyong, ZHANG Shanglong, SUN Yajie, XIAO Jingyi, WU Shanwei, GAO Jiakai, ZHANG Xin, DUO Yonghao. Research Progress，Existing Problems and Prospects on the Diversity and Function of Arbuscular Mycorrhizal Fungi in Tree Peony [J]. Acta Horticulturae Sinica, 2026, 53(4): 985-996.
[8]	ZUO Yiling, MENG Jingjing, LIU Xinyu, LI Han, YU Chenjie, HE Xueli. Arbuscular Mycorrhizal Fungi and Medicinal Plants：A Review on Growth Regulation and Active Ingredient Synthesis [J]. Acta Horticulturae Sinica, 2026, 53(4): 997-1012.
[9]	DU Lijun, LIU Yingcai, SHI Yanyan, WANG Yang, LI Chunhui, HE Yintao, WANG Xu, BIAN Chuanjie, ZHANG Manrang. Effect of Arbuscular Mycorrhizal Fungi on the Growth and Mechanism of Different Apple Cultivar Under Salt-Alkali Stress [J]. Acta Horticulturae Sinica, 2025, 52(9): 2410-2424.
[10]	ZHAO Yupu, BAI Yihan, HOU Saisai, PU Zitian, NIE Lanchun, LI Qingyun, and WANG Xinxin. Research Progress of Alleviating Continuous Cropping Obstacles in Facilities Vegetables Soil Using Arbuscular Mycorrhizal Fungi [J]. Acta Horticulturae Sinica, 2025, 52(8): 2166-2186.
[11]	ZHOU Tian, LÜ Shuaili, HAN Han, LI Yujia, LIU Haiqiang, and LIU Yongzhong. Effect of Exogenous Strigolactones on the Secondary Growth of Poncirus trifoliata Seedlings Stem [J]. Acta Horticulturae Sinica, 2025, 52(7): 1843-1854.
[12]	LI Ao, ZHENG Xu, WU Chengxu, NIE Ruining, JI Xinying, TANG Jiali, ZHANG Junpei. The Effect of Arbuscular Mycorrhizal Fungi on the Growth and Physiological Characteristics of Walnut Seedlings Under Salt Stress [J]. Acta Horticulturae Sinica, 2025, 52(2): 423-438.
[13]	LI Chaonan, LI Lu, GAO Danlei, QIAO Hongyong, YUAN Tao. Differences in Arbuscular Mycorrhizal Fungi Community in the Roots and Rhizosphere Soil of Paeonia ludlowii Between Original Site and Introduction Site [J]. Acta Horticulturae Sinica, 2025, 52(2): 467-480.
[14]	CHEN Mengru, WU Qing’an, HE Sijia, CAI Xiangbin, MA Qiaoli, GU Qingqing, WEI Qingjiang. Genomic-Wide Identification and Expression Analysis of the DNA Methylation-Modifying Enzyme Genes in Poncirus trifoliata [J]. Acta Horticulturae Sinica, 2025, 52(12): 3167-3179.
[15]	LU Jianzeng, ZHOU Liyan, HUANG Xinyi, WU Fengzhi, GAO Danmei. Effects of Carbon Pool Strength on Plant Growth and Potassium Uptake of Tomato Intercropped with Potato-Onion [J]. Acta Horticulturae Sinica, 2024, 51(11): 2620-2632.